Python Dummy

I want to use the new 'People nearby' feature from Telegram. I want to do it in python so I… Read more How To Use Contacts.getlocated() From Telegram Api With Telethon?

I am using regex to parse float number from the string. re.findall('[^a-zA-Z:][-+]?\d+[\.]?\d*… Read more Python Regex To Get Float Number From String

I used pip install django-celeryand pip3 install django-celery in Pycharm. After that I use import … Read more Module Can't Be Installed In Django Virtual Environment

from a string say dna = 'ATAGGGATAGGGAGAGAGCGATCGAGCTAG' i got substring say dna.format = &… Read more How To Select Only Certain Substrings

I'm attempting use caffe and python to do real-time image classification. I'm using OpenCV … Read more Python Real Time Image Classification Problems With Neural Networks

Every time I make a change to a python script I have to reload python and re-import the module. Ple… Read more Need To Restart Python In Terminal Every Time A Change Is Made To Script

How to get all partitions of a set? For example, I have array [1, 2, 3]. I need to get [[1], [2], … Read more Get All The Partitions Of The Set Python With Itertools

I'm trying to use numpy.multiply.outer on multidimensional arrays, and I really need it to assu… Read more How To Multiply.outer() In Numpy While Assuming 0 * Infinity = 0?

I'm using python 2.7.11 on a windows 10 machine where I'm updating a file using VBA contain… Read more Python To Close A Workbook Using Win32com

Suppose I have the following tables: Articles with fields article_id, title Tags with fields tag_i… Read more How To Do A Join In Sqlalchemy On 3 Tables, Where One Of Them Is Mapping Between Other Two?

I have a pandas dataframe that I would like to use an apply function on to generate two new columns… Read more Pandas Apply Function That Returns Two New Columns

I'm pretty new to Python and a Jupyter Notebook Novice. I'm trying to follow along with an … Read more What To Do When Conda Can't Find A Python Package?

Before building a model I make scaling like this X = StandardScaler(with_mean = 0, with_std = 1).fi… Read more Names Features Importance Plot After Preprocessing

I am trying to add multiple 'or' clauses to a python if statement using list comprehension.… Read more Testing Multiple String 'in' Conditions In List Comprehension

Given that l is a list of integers and win is an integer, the following code produces a list lpadde… Read more Can Someone Explain This Statement? Lpadded = Win // 2 * [-1] + L + Win // 2 * [-1]

I'm trying to call from my gmail api code so I can create a draft, but I can't figure out w… Read more Where Do I Get The Authorized Gmail Api Service Instance? (python, Gmail Api)

I don't really have idea about that so I'd like you to give me some advice if you can. Gene… Read more Selenium Python Load Page And Script (firefox And Ie)

Right now I am creating a text file, and then writing som text to it with the command (in python 3)… Read more What Is The Filepath Difference Between Window And Linux In Python3?

The following code is a sample of non-asynchronous code, is there any way to get the images asynchr… Read more Asynchronously Get And Store Images In Python

I need to convert float64 type to datetime format. As an example 20181219.0 data, I want is as 2018… Read more Errors In Converting Float64 Column To Datetime Pandas

im not trying to do this smart or fast, just trying to do it at all. i have a file looks like this … Read more How Do I Import From A Unicode (utf-8) Csv File Into A Numpy Array

Right...so, I have two lists. One has 16 entries. The other at least has a couple hundred. Outputti… Read more Easygui Output?

When i run my program (anagram solver) i get error Unhashable type: list, thats when i turned word… Read more Unhashable Type List Python

This is a follow up of this question. I am trying to utilize 8 GPUs for training and am using the m… Read more Keras Multiple_gpu_model Causes "can't Pickle Module Object" Error

Reviewing some of my code and I realized I had written what is essentially:' if (any(predicate … Read more Difference Between 'any' With Generator-comprehension And Comprehension Without Parentheses?

I want to use an LSTM neural Network with keras to forecast groups of time series and I am having t… Read more Dimensions Not Matching In Keras Lstm Model

I'm wondering if it's possible to compare values in regexps with the regexp system in Pytho… Read more Regexp To Check If An Ip Is Valid

How can I read and update a variable shared between multiple workers in Python? For example, I'… Read more Share A Variable Between Workers With Python Multiprocessing

I have a list of values like: values = [1, 2, 3, 4] and I want to try all combinations on this lis… Read more Trying All Combinations Of Operations On List Of Variables

I'm confused about the way IronPython loads modules while being hosted. I'm using IronPytho… Read more How Does Ironpython Loads Modules While Being Hosted?

I'm running into memory issues when trying to read in massive feature files (see below). I figu… Read more Training A Keras Model On Multiple Feature Files That Are Read In Sequentially To Save Memory

I want to receive JSON strings from MQTT and parse them to DataFrames df. How can I do it? This is … Read more How To Get Dataframe In Structured Streaming?

How to select the rows that before a certain value in the columns first appear? I have a dataset of… Read more Selecting All Rows Before A Certain Entry In A Pandas Dataframe

I am trying to get Python to allow me to insert a space at regular intervals (every 5th character),… Read more Python 3.4- Inserting Spaces At Regular Intervals

this seems like it should be an easy one but I can't figure it out. I have a pandas data frame … Read more Scatter Plots With String Arrays In Matplotlib

I have a Numpy array of datetime64 objects that I need to convert to a specific time format yyyy-mm… Read more Replace A Single Character In A Numpy List Of Strings

I have a list of Ordereddict as follows list1= [OrderedDict([('Numbers', '15'), (&… Read more Display List Of Ordereddict In Kivy

When I run the below code with psycopg2: cur.execute( '''INSERT INTO logmsg (msg_ty… Read more Typeerror: Not All Arguments Converted During String Formatting In Psycopg2

Is there a good way to download a lot of files en masse using python? This code is speedy enough fo… Read more Downloading A Lot Of Files Using Python

I have two columns in my pandas DataFrame. A B 0 1 5 1 2 3 2 3 2 3 4 … Read more Conditional Selection Of Data In A Pandas Dataframe

I am now trying to prepare the input data for LSTM-based NN. I have some big number of text documen… Read more Creating Sequence Vector From Text In Python

i want to get in inline formset factory in update view extra=0, if it have more than 1 contact. So… Read more Inline Formset Factory Update View

I am trying to extract object, xmin, ymin, xmax and xmax value of every object tag there is. XML … Read more How To Get Specific Values From A Xml File Into Csv File Using Python?

I have a dataframe for tennis players results : match match_date score result player_name … Read more Create New Dataframe For Each Tennis Player

I'm playing around with win32com.client for python to try to write/insert a row to a MS Access … Read more Write To Ms Access Table, Python Win32com

I have a dataframe with a column of timestamps that I'd like to write to a CSV file, but runnin… Read more Pandas To_csv Makes Timestamps Into Tuples

I'd like to create a Model Class for an User. The data of the user are stored in an document ba… Read more Python Decorator Also For Undefined Attributes

while True: now = datetime.datetime.now() if now.weekday() == 5: if now.hour() == 1… Read more I'm Trying To Create An Alarm Clock But It Gives Back This - Typeerror: 'int' Object Is Not Callable

I'm writing my own custom context_processor on django (1.11) and to get infos of an authenticat… Read more Django Writing Custom Context Processor

Hi I am having a hard time understanding how to use the BSD only python module classes select.kqueu… Read more Check If File Is Modified Deleted Or Extended Using Python Select.kqueue()

I am trying to create a bar chart with matplotlib. The x-axis data is a list with years: [1950,1960… Read more Too Much Space Between Bars In Matplotlib Bar Chart

I'm playing around with the abalone dataset from UCI's machine learning repository. I want… Read more Missing Labels In Matplotlib Correlation Heatmap

I have a dataframe structured like below: Column A Column B 1 A 1 B 1 … Read more Concatenate Rows In A Dataframe

I am trying to read a png image in python. The imread function in scipy is being deprecated and the… Read more How To Read Images Into A Script Without Using Using Imageio Or Scikit Image?

I would like to add aditional augmenmentation this way: additional_aug=[zoom_crop(scale=(0.75,… Read more How To Get Add Aditional Transform To Get_transform In Fastai?

Let's say I want to display my own 404 & 500 pages, I've found 2 possibilities so far: … Read more Cherrypy: What Is The Difference Between `error_page.default` Vs. `error_page.404` Config Settings?

I have a treeview display of invoice related data. The invoice identifiers have underscores. I have… Read more Tkinter Treeview Row Display Value Discrepancy With Underscore

I am using macOS Sierra(on GPU support) with python3.7.0 installed. Whenever I am trying to install… Read more Issues While Installing Tensorflow For Python 3.7 In Mac