Python Dummy

from a string say dna = 'ATAGGGATAGGGAGAGAGCGATCGAGCTAG' i got substring say dna.format = &… Read more How To Select Only Certain Substrings

# File Name RandonProteinSequences.py # standard library import os import random # biopython from … Read more Importerror: No Module Named Writers.seqrecord.fasta

I have a text file as shown below ATOM 920 CA GLN A 203 39.292 -13.354 17.416 1.00 55.7… Read more Calculating The Distance Between Atomic Coordinates

i have a dataset (for compbio people out there, it's a FASTA) that is littered with newlines, t… Read more Pandas Read Csv Ignore Newline

Using a typical pdb file, I am able to calculate the distance between two atoms in a structure usin… Read more Biopython Pdb: Calculate Distance Between An Atom And A Point

I'm trying to implement the Smith-Waterman algorithm for local sequence alignment using the aff… Read more Traceback In Smith-Wateman Algorithm With Affine Gap Penalty